Stem-loop sequence gma-MIR5677

AccessionMI0019277 (change log)
DescriptionGlycine max miR5677 stem-loop
Stem-loop
   c    c     c g a      c   a       uc    ga       ---     -----------u    agaagg   c  gaagcaccagucaugagaguagauugcaugguuu 
5'  acga agcca u a cuuggu aaa accaaau  ucag  auauuau   ucaug            acaa      cca ug                                  u
    |||| ||||| | | |||||| ||| |||||||  ||||  |||||||   |||||            ||||      ||| ||                                   
3'  uguu uuggu a u gaacua uuu ugguuua  aguu  uauagua   gguac            uguu      ggu ac                                  u
   -    -     a g c      a   c       ga    uc       aau     uuuagagauaau    gaagga   u  aggaacgagagaaaggggagaaaaagucuucuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 14817220-14817443 [-]
intergenic
Database links

Mature sequence gma-miR5677

Accession MIMAT0022465
Sequence

194 - 

uuuggucuuuaaucaagcuga

 - 214

Get sequence
Evidence experimental; Illumina [1], RT-PCR [1]

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).