Stem-loop sequence mtr-MIR5206b

AccessionMI0019697 (change log)
DescriptionMedicago truncatula miR5206b stem-loop
Gene family MIPF0001288; MIR5037
Stem-loop
   g     c           -    a  c        ---aa      guua        -   a 
5'  aaggc uucaguaaccc ucaa gg uuccaugg     ucacau    ugguuaga uua u
    ||||| ||||||||||| |||| || ||||||||     ||||||    |||||||| |||  
3'  uuucg aagucauuggg aguu cc agggugcu     agugua    accaguuu aau c
   -     a           u    g  u        aaaaa      -gug        c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 23959036-23959156 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR5206b
mtr-MIR5204chr7: 23966861-23966946 [+]
mtr-MIR5037cchr7: 23961112-23961230 [-]
mtr-MIR5206bchr7: 23959036-23959156 [-]
mtr-MIR5037bchr7: 23954301-23954389 [-]
Database links

Mature sequence mtr-miR5206b

Accession MIMAT0023152
Sequence

90 - 

gugggauccguugauggguuac

 - 111

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).