Stem-loop sequence hco-mir-265

AccessionMI0020177 (change log)
DescriptionHaemonchus contortus miR-265 stem-loop
Literature search

1 open access papers mention hco-mir-265
(1 sentences)

Stem-loop
   ggggaaagagcuauccagugccgcccaaac         g a   aaaacug        aaa 
5'                               cucauuauu c uuc       ccuucagu   g
                                 ||||||||| | |||       ||||||||    
3'                               ggguaauaa g aag       gggaguua   a
   -----------------------uuccaaa         g g   -----ga        gaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hco-miR-265

Accession MIMAT0023508
Sequence

71 - 

ugagggaggaagggaauaau

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).