Stem-loop sequence ame-mir-6004

AccessionMI0020214 (change log)
DescriptionApis mellifera miR-6004 stem-loop
Stem-loop
   -    a   uaac     g     uaau       u    --aa      
5'  ggau cgu    gaaug agcgu    gaucgug uucu    auugu 
    |||| |||    ||||| |||||    ||||||| ||||    |||| a
3'  ucug gca    cuugc uugcg    uuagcac gaga    uaacu 
   c    -   ---u     g     ----       u    gcag      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000058.5: 8491723-8491810 [-]
intergenic
Database links

Mature sequence ame-miR-6004-5p

Accession MIMAT0023547
Sequence

13 - 

gaauggagcguuaaugaucg

 - 32

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ame-miR-6004-3p

Accession MIMAT0023548
Sequence

64 - 

cgauugcguugcguucuac

 - 82

Get sequence
Evidence experimental; SOLiD [1], Illumina [3]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:22171334 "Detection of microRNAs in color space" Marco A, Griffiths-Jones S Bioinformatics. 28:318-323(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).