Stem-loop sequence ame-mir-6000b

AccessionMI0020308 (change log)
DescriptionApis mellifera miR-6000b stem-loop
Stem-loop
   u  a     cgu            u     -a     aauu 
5'  ug ugaug   cuuguggguacu cucgu  cuaua    u
    || |||||   |||||||||||| |||||  |||||     
3'  ac acugc   gagcacccauga gagca  gauau    g
   c  c     --u            u     ga     agua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000057.5: 11872166-11872246 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-6000b
ame-mir-6000aCM000057.5: 11872162-11872259 [-]
ame-mir-6000bCM000057.5: 11872166-11872246 [+]
ame-mir-6040CM000057.5: 11872753-11872831 [-]
Database links

Mature sequence ame-miR-6000b-3p

Accession MIMAT0023661
Sequence

49 - 

uagagacgaguaguacccacgag

 - 71

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22458842 "Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers" Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S Insect Mol Biol. 21:297-303(2012).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).