Stem-loop sequence cgr-mir-194

AccessionMI0020440 (change log)
DescriptionCricetulus griseus miR-194 stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   ------       cau         a      g    cu  gg 
5'       gucauca   guaacagca cuccau ugga  gu  g
         |||||||   ||||||||| |||||| ||||  ||   
3'       cgguagu   cauugucgu gaggug accu  ca  c
   aaccac       ucu         g      -    -u  gu 
Get sequence
Deep sequencing
43927 reads, 250 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CriGri_1.0; GCA_000223135.1) Overlapping transcripts
JH000002.1: 3326794-3326873 [+]
intergenic
Clustered miRNAs
< 10kb from cgr-mir-194
cgr-mir-194JH000002.1: 3326794-3326873 [+]
cgr-mir-215JH000002.1: 3327065-3327141 [+]
Database links

Mature sequence cgr-miR-194

Accession MIMAT0023827
Sequence

10 - 

uguaacagcaacuccaugugga

 - 31

Get sequence
Deep sequencing21790 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).