Stem-loop sequence mes-MIR171a

AccessionMI0020964 (change log)
DescriptionManihot esculenta miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention mes-MIR171a
(23 sentences)

Stem-loop
           u    --cauagg   ---             c          -u   a        uga 
5' ggagagag ggug        uga   agauauuggcgug cucaaucuaa  uac ugguuaaa   u
   |||||||| ||||        |||   ||||||||||||| ||||||||||  ||| ||||||||    
3' ucucucuc ccac        acu   ucuauaacugcgc gaguuagguu  aug accgauuu   a
           u    uuuaauua   ucc             c          uc   a        ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05214: 128472-128603 [-]
intergenic
Database links

Mature sequence mes-miR171a

Accession MIMAT0024415
Sequence

87 - 

uugagccgcgucaauaucucc

 - 107

Get sequence
Evidence experimental; Illumina [2]

References

1
"Overview of the potential of microRNAs and their target gene detection for cassava (Manihot esculenta) improvement" Amiteye S, Corral JM, Sharbel TF African J Biotech. 10:(2011).
2
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).