Stem-loop sequence hvu-MIR5049e

AccessionMI0021516 (change log)
DescriptionHordeum vulgare miR5049e stem-loop
Gene family MIPF0001200; MIR5067
Literature search

2 open access papers mention hvu-MIR5049e
(4 sentences)

Stem-loop
   a     u         c  c                 a        ag 
5'  ucuau uacuuccuc gu ccuaaauaauuguaguu gagagaau  u
    ||||| ||||||||| || ||||||||||||||||| ||||||||   
3'  ggaug augagggag ca ggauuuauuaacaucaa cuuucuug  u
   a     u         a  u                 c        au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR5049e

Accession MIMAT0024826
Sequence

68 - 

aauuauuuagguacagaggga

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22489137 "Identification and characterization of microRNAs from barley (Hordeum vulgare L.) by high-throughput sequencing" Lv S, Nie X, Wang L, Du X, Biradar SS, Jia X, Weining S Int J Mol Sci. 13:2973-2984(2012).