Stem-loop sequence ppe-MIR482b

Accession

MI0021610 (change log)

Description

Prunus persica miR482b stem-loop

Gene family

MIPF0000403; MIR482

Literature search

2 open access papers mention ppe-MIR482b
(6 sentences)

Stem-loop

   --   u  a         uag            a       aaacaugcaccccaaguguucgugaau 
5'   agu gc guagggagu   gggaaugggagg uugggaa                           a
     ||| || |||||||||   |||||||||||| |||||||                            
3'   ucg ug cauccuuua   uccuuacccucc aacccuu                           u
   uc   u  a         uua            a       cuucaggaaaaaacacaaggaacacau 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context

• Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2): chrG1: 30622467-30622602 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ppe-MIR482b

• ppe-MIR482a: chrG1: 30620009-30620128 [+]
• ppe-MIR482e: chrG1: 30620690-30620817 [+]
• ppe-MIR482b: chrG1: 30622467-30622602 [+]
• ppe-MIR482f: chrG1: 30625526-30625670 [+]

Database links

• miRBase Tracker:MI0021610

Mature sequence ppe-miR482b-5p

• Accession: MIMAT0031166
• Sequence: 21 - ggaaugggaggauugggaaaa - 41
• Evidence: experimental; Illumina [2]

Mature sequence ppe-miR482b-3p

• Accession: MIMAT0027273
• Sequence: 95 - cuucccaaaccucccauuccua - 116
• Evidence: experimental; Illumina [1-2]

References

1. PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).
2. PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).