Stem-loop sequence ppe-MIR171f

AccessionMI0021611 (change log)
DescriptionPrunus persica miR171f stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

6 open access papers mention ppe-MIR171f
(16 sentences)

Stem-loop 
   au   u    c         c       c     -ga   u aa 
5'   agu acug gauguuggc cgguuca ucaga   aga g  u
     ||| |||| ||||||||| ||||||| |||||   ||| |   
3'   ucg ugac cuauaaccg gccgagu aguuu   ucu c  u
   uc   -    u         u       u     aag   u cc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 33174516-33174603 [+]
intergenic
Database links

Mature sequence ppe-miR171f

Accession MIMAT0027274
Sequence

58 -  

ugauugagccgugccaauauc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).