![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ppe-MIR6260 |
|||||
Accession | MI0021613 (change log) | ||||
Description | Prunus persica miR6260 stem-loop | ||||
Literature search |
1 open access papers mention ppe-MIR6260 | ||||
Stem-loop |
uucuc aaa c u a g 5' acuu cucccauucuc ucacucuguc gaaaaguua uuca a |||| ||||||||||| |||||||||| ||||||||| |||| g 3' ugaa gaggguaagag agugagguag cuuuucaau gggu c uuuua cug - c g a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ppe-miR6260 |
|
Accession | MIMAT0027276 |
Sequence |
72 - uggagugagagaaugggaggu - 92 |
Evidence | experimental; Illumina [1] |
References |
|
1 |