Stem-loop sequence ppe-MIR6260

AccessionMI0021613 (change log)
DescriptionPrunus persica miR6260 stem-loop
Literature search

1 open access papers mention ppe-MIR6260
(1 sentences)

Stem-loop
   uucuc    aaa           c          u         a    g 
5'      acuu   cucccauucuc ucacucuguc gaaaaguua uuca a
        ||||   ||||||||||| |||||||||| ||||||||| |||| g
3'      ugaa   gaggguaagag agugagguag cuuuucaau gggu c
   uuuua    cug           -          c         g    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 41542961-41543062 [+]
intergenic
Database links

Mature sequence ppe-miR6260

Accession MIMAT0027276
Sequence

72 - 

uggagugagagaaugggaggu

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1