Stem-loop sequence ppe-MIR828

Accession

MI0021619 (change log)

Description

Prunus persica miR828 stem-loop

Gene family

MIPF0000544; MIR828

Literature search

3 open access papers mention ppe-MIR828
(28 sentences)

Stem-loop

   aa       u        u      c          uc  agccacaguugcaugcaguuug 
5'   uccucuu guaauguu cuugcu aaaugaguau  ca                      c
     ||||||| |||||||| |||||| ||||||||||  ||                       
3'   aggagaa cauugcga gaacga uuuacucgua  gu                      a
   ga       -        c      c          ga  cuuaacgucuucguggucacga 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context

• Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2): chrG2: 29568537-29568661 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0021619

Mature sequence ppe-miR828-5p

• Accession: MIMAT0031168
• Sequence: 19 - ucuugcucaaaugaguauucca - 40
• Evidence: experimental; Illumina [2]

Mature sequence ppe-miR828-3p

• Accession: MIMAT0027282
• Sequence: 95 - ucauuucagcaagcagcguua - 115
• Evidence: experimental; Illumina [1-2]

References

1. PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).
2. PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).