Stem-loop sequence ppe-MIR171h

AccessionMI0021622 (change log)
DescriptionPrunus persica miR171h stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

6 open access papers mention ppe-MIR171h
(16 sentences)

Stem-loop 
   -------------  ug  uauauacauaau a             c       u   -g          uauau g 
5'              ug  aa            g agguauuggcgcg cucaauu gaa  gcaugguuaa     g a
                ||  ||            | ||||||||||||| ||||||| |||  ||||||||||     |  
3'              ac  uu            c ucuauaacugcgc gaguuag cuu  uguaccgauu     c g
   uguaccucucucu  gu  -----------u c             c       u   ag          ----c a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG3: 21868080-21868206 [+]
intergenic
Database links

Mature sequence ppe-miR171h

Accession MIMAT0027285
Sequence

87 -  

uugagccgcgucaauaucucc

 - 107

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).