![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ppe-MIR171h |
|||||
Accession | MI0021622 (change log) | ||||
Description | Prunus persica miR171h stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
6 open access papers mention ppe-MIR171h | ||||
Stem-loop |
------------- ug uauauacauaau a c u -g uauau g 5' ug aa g agguauuggcgcg cucaauu gaa gcaugguuaa g a || || | ||||||||||||| ||||||| ||| |||||||||| | 3' ac uu c ucuauaacugcgc gaguuag cuu uguaccgauu c g uguaccucucucu gu -----------u c c u ag ----c a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ppe-miR171h |
|
Accession | MIMAT0027285 |
Sequence |
87 - uugagccgcgucaauaucucc - 107 |
Evidence | experimental; Illumina [1] |
References |
|
1 |