Stem-loop sequence ppe-MIR477b

AccessionMI0021625 (change log)
DescriptionPrunus persica miR477b stem-loop
Gene family MIPF0000216; MIR477
Stem-loop 
           --aa    c    u    uc                  auguua     cc   au 
5' cuaaggag    gguu caac uccc  aagggcucccaauauucc      auacu  gau  c
   ||||||||    |||| |||| ||||  ||||||||||||||||||      |||||  |||   
3' gguuccuc    ccga guug aggg  uucucggggguuguaagg      uauga  cua  a
           guuc    a    c    uu                  -----g     -a   aa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG3: 15489969-15490090 [-]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR477b
ppe-MIR477bchrG3: 15489969-15490090 [-]
ppe-MIR477achrG3: 15484911-15485032 [-]
Database links

Mature sequence ppe-miR477b-5p

Accession MIMAT0031171
Sequence

21 -  

ucccucaagggcucccaauauu

 - 42

Get sequence
Evidence experimental; Illumina [2]

Mature sequence ppe-miR477b-3p

Accession MIMAT0027288
Sequence

82 -  

guugggggcucuuuugggacg

 - 102

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).
2
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).