![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ppe-MIR477b |
||||||
Accession | MI0021625 (change log) | |||||
Description | Prunus persica miR477b stem-loop | |||||
Gene family | MIPF0000216; MIR477 | |||||
Stem-loop |
--aa c u uc auguua cc au 5' cuaaggag gguu caac uccc aagggcucccaauauucc auacu gau c |||||||| |||| |||| |||| |||||||||||||||||| ||||| ||| 3' gguuccuc ccga guug aggg uucucggggguuguaagg uauga cua a guuc a c uu -----g -a aa |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence ppe-miR477b-5p |
|
Accession | MIMAT0031171 |
Sequence |
21 - ucccucaagggcucccaauauu - 42 |
Evidence | experimental; Illumina [2] |
Mature sequence ppe-miR477b-3p |
|
Accession | MIMAT0027288 |
Sequence |
82 - guugggggcucuuuugggacg - 102 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 | |
2 |
PMID:22909020
"Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs"
BMC Plant Biol. 12:149(2012).
|