Stem-loop sequence ppe-MIR398a

AccessionMI0021631 (change log)
DescriptionPrunus persica miR398a stem-loop
Gene family MIPF0000107; MIR398
Literature search

5 open access papers mention ppe-MIR398a
(12 sentences)

Stem-loop 
   a     guu ca    a           u     g  uc   ccuc      aca     u 
5'  gaggg   c  cagg gcgaccuggga cacau cg  cac    acauua   caaug g
    |||||   |  |||| ||||||||||| ||||| ||  |||    ||||||   ||||| c
3'  cuucc   g  gucc cgcuggacucu gugua gc  gug    ugugau   guuac u
   -     -au ac    c           u     -  uc   -uua      --c     g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG4: 20111541-20111659 [+]
intergenic
Database links

Mature sequence ppe-miR398a-5p

Accession MIMAT0031173
Sequence

15 -  

ggagcgaccugggaucacaug

 - 35

Get sequence
Evidence experimental; Illumina [2]

Mature sequence ppe-miR398a-3p

Accession MIMAT0027294
Sequence

89 -  

uguguucucaggucgccccug

 - 109

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).
2
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).