Stem-loop sequence ppe-MIR319a

AccessionMI0021637 (change log)
DescriptionPrunus persica miR319a stem-loop
Gene family MIPF0000010; MIR159
Literature search

4 open access papers mention ppe-MIR319a
(5 sentences)

Stem-loop 
   a   gcc   -            ug       aca a        -      cua  ---   g    cu       uc     cc           c  auuaacccuccugcuccugcug 
5'  aug   aug gggagcuccuuu  guccaau   g gggcugag gugugg   ga   gcu ucau  caugcau  ggcua  ccuuaauauuu ua                      u
    |||   ||| ||||||||||||  |||||||   | |||||||| ||||||   ||   ||| ||||  |||||||  |||||  ||||||||||| ||                      g
3'  uac   uac cccucgagggaa  cagguua   c cccgauuc cgcgcc   cu   cga ggug  guacgug  ccgau  ggaauuguaaa gu                      c
   c   -ac   g            gu       -cc a        a      uuc  caa   g    ug       gu     uu           a  auucuuauuaacacguuguguc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG5: 17215362-17215601 [+]
intergenic
Database links

Mature sequence ppe-miR319a

Accession MIMAT0027300
Sequence

211 -  

uuggacugaagggagcuccc

 - 230

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).