Stem-loop sequence ppe-MIR319b

AccessionMI0021640 (change log)
DescriptionPrunus persica miR319b stem-loop
Gene family MIPF0000010; MIR159
Literature search

3 open access papers mention ppe-MIR319b
(4 sentences)

Stem-loop 
   -           a -  g   ag       uc  aa        aaauua 
5'  aggauuuaauu g cu ccg  ucauuca  ca  uacugggu      g
    ||||||||||| | || |||  |||||||  ||  ||||||||      c
3'  uucuagguuaa c ga ggc  aguaagu  gu  augaccca      u
   a           a a  g   ga       gu  aa        caggac
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG5: 11601224-11601324 [-]
intergenic
Database links

Mature sequence ppe-miR319b

Accession MIMAT0027303
Sequence

11 -  

uagcugccgagucauucaucca

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).