Stem-loop sequence ppe-MIR171b

Accession

MI0021646 (change log)

Description

Prunus persica miR171b stem-loop

Gene family

MIPF0000030; MIR171_1

Literature search

6 open access papers mention ppe-MIR171b
(16 sentences)

Stem-loop

   caaaa       c          a         c  a  ca       -a  u c 
5'      gagaaag gauguuggug gguucaauc ga ga  gauuuac  ca g c
        ||||||| |||||||||| ||||||||| || ||  |||||||  || |  
3'      cucuuuc cuauaaccgc ccgaguuag cu cu  uuaaaug  gu c c
   aucaa       a          g         a  -  ag       cc  - g 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context

• Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2): chrG7: 21049795-21049903 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0021646

Mature sequence ppe-miR171b

• Accession: MIMAT0027309
• Sequence: 79 - uugagccgcgccaauaucacu - 99
• Evidence: experimental; Illumina [1]

References

1. PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).