Stem-loop sequence ppe-MIR482e

Accession

MI0021655 (change log)

Description

Prunus persica miR482e stem-loop

Gene family

MIPF0000403; MIR482

Literature search

2 open access papers mention ppe-MIR482e
(6 sentences)

Stem-loop

   g        u     c      a -uuu        a       u      ucuac         u 
5'  aggaaguu uuggc auggga g    ggcaagaa uauuuau auauau     uacuucaag u
    |||||||| ||||| |||||| |    |||||||| ||||||| ||||||     ||||||||| c
3'  uccuuuag aaccg uacccu c    ccguucuu augaaua uguaug     augaaguuu u
   a        u     -      c uuau        g       -      ----u         g 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context

• Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2): chrG1: 30620690-30620817 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ppe-MIR482e

• ppe-MIR482a: chrG1: 30620009-30620128 [+]
• ppe-MIR482e: chrG1: 30620690-30620817 [+]
• ppe-MIR482b: chrG1: 30622467-30622602 [+]
• ppe-MIR482f: chrG1: 30625526-30625670 [+]

Database links

• miRBase Tracker:MI0021655

Mature sequence ppe-miR482e

• Accession: MIMAT0027318
• Sequence: 97 - uugccuauuccucccaugccaa - 118
• Evidence: experimental; Illumina [1]

References

1. PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).