miRBase entry: ppe-MIR171c

Stem-loop ppe-MIR171c


Accession
MI0021660
Description
Prunus persica ppe-MIR171c precursor miRNA

Literature search
6 open access papers mention ppe-MIR171c
(22 sentences)

Sequence


ugaugauguugauguuggcguggcucaaucaaaucaaacuucucaacuguuuauuggguccuuuaauuUGAUUGAGCCGUGCCAAUAUCauuaucaguc
...(((((.(((((((((((((((((((((((((.(((...(((((.......)))))...))).))))))))))))))))))))))))).)))))...

Structure
uga     u                         c   cuu     cu 
   ugaug ugauguuggcguggcucaaucaaau aaa   cucaa  g
   ||||| ||||||||||||||||||||||||| |||   |||||  u
   acuau aCUAUAACCGUGCCGAGUUAGUuua uuu   ggguu  u
cug     u                         a   ccu     au 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
chrG3: 26848360-26848458 [-]

Database links

Mature ppe-miR171c

Accession MIMAT0027323
Description Prunus persica ppe-miR171c mature miRNA
Sequence 69 - UGAUUGAGCCGUGCCAAUAUC - 89
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 22863067
    High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot
    Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L
    BMC Genomics (2012) 13:371