Stem-loop sequence ppe-MIR171c

Accession

MI0021660 (change log)

Description

Prunus persica miR171c stem-loop

Gene family

MIPF0000030; MIR171_1

Literature search

6 open access papers mention ppe-MIR171c
(21 sentences)

Stem-loop

   uga     u                         c   cuu     cu 
5'    ugaug ugauguuggcguggcucaaucaaau aaa   cucaa  g
      ||||| ||||||||||||||||||||||||| |||   |||||  u
3'    acuau acuauaaccgugccgaguuaguuua uuu   ggguu  u
   cug     u                         a   ccu     au 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context

• Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2): chrG3: 26848360-26848458 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0021660

Mature sequence ppe-miR171c

• Accession: MIMAT0027323
• Sequence: 69 - ugauugagccgugccaauauc - 89
• Evidence: experimental; Illumina [1]

References

1. PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).