Stem-loop sequence ppe-MIR398b

AccessionMI0021665 (change log)
DescriptionPrunus persica miR398b stem-loop
Gene family MIPF0000107; MIR398
Literature search

5 open access papers mention ppe-MIR398b
(11 sentences)

Stem-loop 
   u       ca                u   a  -u   ug -c        a   -caa  gg 
5'  ggagccc  caggggugaccugaga cac ug  aug  g  aacagcag acc    ga  g
    |||||||  |||||||||||||||| ||| ||  |||  |  |||||||| |||    ||   
3'  uuucggg  guccccgcuggacucu gug ac  uac  u  uugucguc ugg    cu  c
   c       ac                u   c  cu   gu uc        c   cuug  ac
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG4: 19261810-19261934 [-]
intergenic
Database links

Mature sequence ppe-miR398b

Accession MIMAT0027328
Sequence

95 -  

cguguucucaggucgccccug

 - 115

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22863067 "High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot" Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L BMC Genomics. 13:371(2012).