Stem-loop sequence gma-MIR393c

Accession

MI0021704 (change log)

Description

Glycine max miR393c stem-loop

Gene family

MIPF0000083; MIR393

Literature search

21 open access papers mention gma-MIR393c
(49 sentences)

Stem-loop

   g       c            c    u          -uuc   uuuauaaauuuuu 
5'  gaggagg auccaaagggau gcau gaucccaaau    aga             c
    ||||||| |||||||||||| |||| ||||||||||    |||              
3'  uuccucc uagguuucccua cgua cuaggguuua    ucu             u
   -       u            u    -          uaac   uccccucccuuuc 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Glycine_max_v2.0; GCA_000004515.3): chr2: 44047954-44048066 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0021704

Mature sequence gma-miR393c-5p

• Accession: MIMAT0024910
• Previous IDs: gma-miR393c
• Sequence: 11 - uccaaagggaucgcauugaucc - 32
• Evidence: experimental; Illumina [1]

Mature sequence gma-miR393c-3p

• Accession: MIMAT0032134
• Sequence: 86 - aucaugcuaucccuuuggauu - 106
• Evidence: experimental; Illumina [2]

References

1. PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).
2. PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).