![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR393c |
|||||
Accession | MI0021704 (change log) | ||||
Description | Glycine max miR393c stem-loop | ||||
Gene family | MIPF0000083; MIR393 | ||||
Literature search |
![]()
21 open access papers mention gma-MIR393c | ||||
Stem-loop |
g c c u -uuc uuuauaaauuuuu 5' gaggagg auccaaagggau gcau gaucccaaau aga c ||||||| |||||||||||| |||| |||||||||| ||| 3' uuccucc uagguuucccua cgua cuaggguuua ucu u - u u - uaac uccccucccuuuc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR393c-5p |
|
Accession | MIMAT0024910 |
Previous IDs | gma-miR393c |
Sequence |
11 - uccaaagggaucgcauugaucc - 32 |
Evidence | experimental; Illumina [1] |
Mature sequence gma-miR393c-3p |
|
Accession | MIMAT0032134 |
Sequence |
86 - aucaugcuaucccuuuggauu - 106 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:22559273
"Genome organization and characteristics of soybean microRNAs"
BMC Genomics. 13:169(2012).
|
2 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|