Stem-loop sequence sma-mir-190

AccessionMI0021819 (change log)
DescriptionSchistosoma mansoni miR-190 stem-loop
Gene family MIPF0001853; mir-190_2
Literature search

1 open access papers mention sma-mir-190
(3 sentences)

Stem-loop
   --c   ag       gu     -u       aug       u     -------c        aca 
5'    gau  uagacua  cgaug  gauaugu   gguuacu ggugu        agcggaua   u
      |||  |||||||  |||||  |||||||   ||||||| |||||        ||||||||    
3'    cua  auuugau  gcuau  cuauaca   ccaguga ccaca        ucgcuugu   a
   cua   -g       ac     cc       -ga       -     caaaauua        guu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_1: 34471102-34471222 [+]
intergenic
Database links

Mature sequence sma-miR-190-5p

Accession MIMAT0025027
Sequence

21 - 

ugauauguauggguuacuuggug

 - 43

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-190-3p

Accession MIMAT0025028
Sequence

82 - 

cagugaccagacauaucccu

 - 101

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).