Stem-loop sequence sma-mir-31

AccessionMI0021825 (change log)
DescriptionSchistosoma mansoni miR-31 stem-loop
Gene family MIPF0001803; mir-31_2
Literature search

2 open access papers mention sma-mir-31
(2 sentences)

Stem-loop
   -uguuua         ag    u  c         uaa  ca 
5'        uuguuggca  auua gg gaagcugaa   ac  c
          |||||||||  |||| || |||||||||   ||   
3'        aacaaccgu  uagu cc cuucgacuu   ug  a
   cgguaca         ca    c  -         -ug  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_6: 1777481-1777563 [-]
intergenic
Database links

Mature sequence sma-miR-31-5p

Accession MIMAT0025038
Sequence

11 - 

uggcaagauuauggcgaagcuga

 - 33

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-31-3p

Accession MIMAT0032136
Sequence

53 - 

agcuuccccugauacugccaac

 - 74

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).