Stem-loop sequence sma-mir-36a

AccessionMI0021828 (change log)
Previous IDssma-mir-36
DescriptionSchistosoma mansoni miR-36a stem-loop
Gene family MIPF0000096; mir-36
Literature search

3 open access papers mention sma-mir-36a
(4 sentences)

Stem-loop
   ggu            -     c g       ua     uagauuauu 
5'    auaucuugugaa gagug c acccggu  gccau         g
      |||||||||||| ||||| | |||||||  |||||          
3'    uauaggacgcuu cuuac g ugggcca  cggug         u
   cuu            a     a a       -c     caaagaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_1: 57476968-57477061 [-]
intergenic
Database links

Mature sequence sma-miR-36a-5p

Accession MIMAT0032137
Sequence

13 - 

gaagagugccgacccgguuagcc

 - 35

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-36a-3p

Accession MIMAT0025041
Previous IDssma-miR-36-3p
Sequence

62 - 

ccaccggguagacauucauucgc

 - 84

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).