Stem-loop sequence rno-mir-6317-1

AccessionMI0021839 (change log)
Previous IDsrno-mir-6317
DescriptionRattus norvegicus miR-6317-1 stem-loop
Gene family MIPF0002112; mir-6317
Stem-loop
   aaaga   -  -     -    --cuu    uc  -  g      ac   a   a       g   aa 
5'      ccu cu agucu ccug     gccu  ug cu caguga  cug gag aaggcuc agc  u
        ||| || ||||| ||||     ||||  || || ||||||  ||| ||| ||||||| |||   
3'      gga ga uuagg ggau     uggg  ac ga gucacu  gac cuc uuccggg uug  u
   -----   a  c     u    cuuau    cu  a  g      cu   a   a       g   ga 
Get sequence
Deep sequencing
87 reads, 0 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 259080675-259080801 [-]
sense
ENSRNOT00000020940 ; Aldh18a1-201; intron 4
Database links

Mature sequence rno-miR-6317

Accession MIMAT0025054
Sequence

36 - 

gugaaccugagagaaaggcuc

 - 56

Get sequence
Deep sequencing152 reads, 65 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).