Stem-loop sequence mmu-mir-6338

AccessionMI0021866 (change log)
Symbol MGI:Mir6338
DescriptionMus musculus miR-6338 stem-loop
Stem-loop
   u  a     c  gu       au  g     acuga    u    a  -      aa 
5'  cc guauc ug  uucucuc  uu ugcuu     guuu auau gu cacaua  a
    || ||||| ||  |||||||  || |||||     |||| |||| || ||||||   
3'  gg cguag au  aagaggg  aa augaa     uaaa ugua ca guguau  c
   g  a     u  gu       --  g     ---ag    u    -  u      ac 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 72388756-72388864 [+]
intergenic
Database links

Mature sequence mmu-miR-6338

Accession MIMAT0025081
Sequence

10 - 

cugguuucucucauuugugcu

 - 30

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).