Stem-loop sequence mmu-mir-6339

AccessionMI0021867 (change log)
Symbol MGI:Mir6339
DescriptionMus musculus miR-6339 stem-loop
Stem-loop
   g   g       c  -    u   uuug    c   g       --g  -aaa  a   g 
5'  gca uagaugu ug agga gcc    uccu agu uuaggcu   ag    gg gcu g
    ||| ||||||| || |||| |||    |||| ||| |||||||   ||    || ||| c
3'  ugu guuuaca ac uccu ugg    aggg ucg aauccgg   uc    cc cgg a
   -   -       c  a    c   ucga    u   a       acg  acua  a   g 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 130016292-130016408 [-]
antisense
OTTMUST00000036811 ; Tgm3-001; intron 1
ENSMUST00000110299 ; Tgm3-001; intron 1
Database links

Mature sequence mmu-miR-6339

Accession MIMAT0025082
Sequence

18 - 

gaugccuuuguccucaguguuag

 - 40

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).