Stem-loop sequence mmu-mir-6341

AccessionMI0021869 (change log)
Symbol MGI:Mir6341
DescriptionMus musculus miR-6341 stem-loop
Stem-loop
   u     -      cca      g -ag  g  -     caaug        -a  -auau    g 
5'  uuuca acauau   aaaauu a   ga cc cagug     auauuguc  cu     ggcu a
    ||||| ||||||   |||||| |   || || |||||     ||||||||  ||     ||||  
3'  gaggu ugugug   uuuuaa u   cu gg gucac     uaugauag  ga     ucgg u
   c     c      ---      g caa  g  a     ---aa        ag  cuccu    a 
Get sequence
Deep sequencing
6799 reads, 53.8 reads per million, 80 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 12425986-12426106 [+]
intergenic
Database links

Mature sequence mmu-miR-6341

Accession MIMAT0025084
Sequence

31 - 

cagugcaaugauauugucacuau

 - 53

Get sequence
Deep sequencing6794 reads, 80 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).