Stem-loop sequence mmu-mir-6370

AccessionMI0021899 (change log)
Symbol MGI:Mir6370
DescriptionMus musculus miR-6370 stem-loop
Stem-loop
   u      aua g  g    cuga       ua  g  -g     a   -   aag  -   g 
5'  cucuuc   u uu gcug    ugucuug  ug au  uuaug uuc ucu   ac uug g
    ||||||   | || ||||    |||||||  || ||  ||||| ||| |||   || |||  
3'  gagaag   g aa cgac    acggaac  ac ua  gauac agg aga   ug aac a
   u      --g g  a    aagg       ca  g  ga     -   u   cga  u   g 
Get sequence
Deep sequencing
8 reads, 71.4 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 19555342-19555461 [+]
intergenic
Database links

Mature sequence mmu-miR-6370

Accession MIMAT0025114
Sequence

97 - 

gcaggaacagcaaaggggaag

 - 117

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).