Stem-loop sequence mmu-mir-6371

AccessionMI0021900 (change log)
Symbol MGI:Mir6371
DescriptionMus musculus miR-6371 stem-loop
Stem-loop
   a       --ac   -   u  a   uu    u     ---     gc    -g   ca 
5'  gauggga    uca uug ac uuu  gaag aguuu   gucau  ugga  guu  u
    |||||||    ||| ||| || |||  |||| |||||   |||||  ||||  |||   
3'  cuauccu    agu gac ug agg  cuuc ucgaa   cggug  acuu  cgg  u
   a       cucu   u   u  a   gu    -     guu     -a    ga   au 
Get sequence
Deep sequencing
86 reads, 81.8 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 50572398-50572508 [+]
sense
OTTMUST00000087065 ; RP23-198D7.2-001; intron 1
OTTMUST00000087066 ; RP23-198D7.2-002; intron 1
ENSMUST00000147260 ; 5430402O13Rik-001; intron 1
ENSMUST00000126537 ; 5430402O13Rik-002; intron 1
Database links

Mature sequence mmu-miR-6371

Accession MIMAT0025115
Sequence

62 - 

uucaaguggcuugaagcucuucu

 - 84

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).