Stem-loop sequence mmu-mir-6383

AccessionMI0021914 (change log)
Symbol MGI:Mir6383
DescriptionMus musculus miR-6383 stem-loop
Stem-loop
   c      ----       cu   a    cug    acgga           ca   uc   uaa 
5'  agcaug    uggaaca  gua agug   uguc     cacugacuuuu  aag  cag   g
    ||||||    |||||||  ||| ||||   ||||     |||||||||||  |||  |||   u
3'  uuguac    gucuugu  cgu ucau   acgg     gugacuggaga  uuc  guc   c
   u      cccg       au   a    --a    -----           --   --   uga 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 136183245-136183360 [+]
intergenic
Database links

Mature sequence mmu-miR-6383

Accession MIMAT0025129
Sequence

18 - 

uaaagugcugugucacggaca

 - 38

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).