Stem-loop sequence mmu-mir-6385

AccessionMI0021916 (change log)
Symbol MGI:Mir6385
DescriptionMus musculus miR-6385 stem-loop
Literature search

1 open access papers mention mmu-mir-6385
(1 sentences)

Stem-loop 
   c      aa     a  ga     a    a g  cu      --   ag    c 
5'  cagggc  ggaug ca  gagga gacu g gg  uccagg  aca  gagu g
    ||||||  ||||| ||  ||||| |||| | ||  ||||||  |||  ||||  
3'  gucccg  ucuau gu  cuccu uugg c uc  gggucc  ugu  cuca c
   u      gg     -  -a     -    a g  uu      aa   cu    a
Get sequence
Deep sequencing
36 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 58221150-58221254 [+]
antisense
OTTMUST00000083660 ; Pml-012; intron 1
OTTMUST00000083659 ; Pml-011; intron 2
OTTMUST00000083658 ; Pml-010; intron 3
OTTMUST00000083650 ; Pml-002; intron 7
OTTMUST00000083653 ; Pml-005; intron 7
OTTMUST00000083649 ; Pml-001; intron 8
OTTMUST00000083652 ; Pml-004; intron 8
OTTMUST00000083651 ; Pml-003; 3'UTR (exon 8)
ENSMUST00000124063 ; Pml-012; intron 1
ENSMUST00000154572 ; Pml-011; intron 2
ENSMUST00000148628 ; Pml-010; intron 3
ENSMUST00000114136 ; Pml-002; intron 7
ENSMUST00000126690 ; Pml-005; intron 7
ENSMUST00000085673 ; Pml-001; intron 8
ENSMUST00000135310 ; Pml-004; intron 8
ENSMUST00000153820 ; Pml-003; 3'UTR (exon 8)
Database links

Mature sequence mmu-miR-6385

Accession MIMAT0025131
Sequence

6 -  

gcaaggaugacagagaggaag

 - 26

Get sequence
Deep sequencing27 reads, 18 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).