Stem-loop sequence mmu-mir-6389

AccessionMI0021922 (change log)
Symbol MGI:Mir6389
DescriptionMus musculus miR-6389 stem-loop
Stem-loop
   c    ua     -u  aa    a   ---uu   -  -aac    c       uu 
5'  cucc  agcag  gc  uguu aac     ugc ca    uccc aagcuag  u
    ||||  |||||  ||  |||| |||     ||| ||    |||| |||||||   
3'  gagg  uuguu  cg  acaa uug     aug gu    aggg uucgauc  u
   u    --     uu  --    c   uguuu   u  gauc    u       cg 
Get sequence
Deep sequencing
3409 reads, 43.3 reads per million, 67 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 57581061-57581162 [+]
intergenic
Database links

Mature sequence mmu-miR-6389

Accession MIMAT0025137
Sequence

10 - 

cagugcaauguuaaacuuugc

 - 30

Get sequence
Deep sequencing3407 reads, 67 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).