Stem-loop sequence mmu-mir-6394

AccessionMI0021928 (change log)
Symbol MGI:Mir6394
DescriptionMus musculus miR-6394 stem-loop
Literature search

1 open access papers mention mmu-mir-6394
(2 sentences)

Stem-loop
   a    uu    --    ---       ----       acug   c     u u 
5'  gcug  gccu  uucc   caggggc    cgaggag    ugc uugaa g g
    ||||  ||||  ||||   |||||||    |||||||    ||| ||||| | a
3'  cgac  ugga  gggg   gucccug    guuccuc    aug aacuu c a
   c    uc    cc    uga       uguc       ---g   a     c u 
Get sequence
Deep sequencing
15 reads, 8.33 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 96305667-96305765 [+]
sense
OTTMUST00000050320 ; Odz4-001; intron 1
OTTMUST00000050321 ; Odz4-002; intron 1
OTTMUST00000050322 ; Odz4-003; intron 1
OTTMUST00000050323 ; Odz4-004; intron 1
OTTMUST00000050347 ; Odz4-009; intron 1
OTTMUST00000050348 ; Odz4-010; intron 1
OTTMUST00000050349 ; Odz4-011; intron 1
ENSMUST00000107162 ; Tenm4-001; intron 1
ENSMUST00000144263 ; Tenm4-003; intron 1
ENSMUST00000133770 ; Tenm4-011; intron 1
ENSMUST00000129445 ; Tenm4-002; intron 1
ENSMUST00000138760 ; Tenm4-004; intron 1
ENSMUST00000107166 ; Tenm4-009; intron 1
ENSMUST00000107165 ; Tenm4-010; intron 1
Database links

Mature sequence mmu-miR-6394

Accession MIMAT0025144
Sequence

74 - 

ucccugaguggggccaggucu

 - 94

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).