Stem-loop sequence mmu-mir-6404

AccessionMI0021940 (change log)
Symbol MGI:Mir6404
DescriptionMus musculus miR-6404 stem-loop
Stem-loop
   a    -    aca     g   au a    c a  a   g  -   ag 
5'  cauu cuac   gcccu uac  c uguc c uc cua ag gac  u
    |||| ||||   ||||| |||  | |||| | || ||| || |||   
3'  gugg ggug   cgggg aug  g acag g ag ggu uc cug  g
   g    u    -ga     g   gg a    u a  -   g  u   aa 
Get sequence
Deep sequencing
22 reads, 107 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 143933115-143933208 [+]
intergenic
Database links

Mature sequence mmu-miR-6404

Accession MIMAT0025156
Sequence

57 - 

gugggaagugacaagggguag

 - 77

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).