Stem-loop sequence mmu-mir-6405

AccessionMI0021941 (change log)
Symbol MGI:Mir6405
DescriptionMus musculus miR-6405 stem-loop
Stem-loop 
   u        cca        agg      ---   u    uc    - uuga      u  a   u 
5'  caccccau   gcuuucca   gcuucu   uuc gacu  cugg c    uuuggg uc ugg g
    ||||||||   ||||||||   ||||||   ||| ||||  |||| |    |||||| || ||| a
3'  guggggug   cgaagggu   cgaagg   aag uuga  gacc g    gaaccc ag acc g
   c        --a        -ga      gug   u    --    u -uug      c  -   a
Get sequence
Deep sequencing
30 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 44808406-44808529 [+]
sense
OTTMUST00000097087 ; Pax2-004; intron 4
OTTMUST00000097085 ; Pax2-001; intron 5
ENSMUST00000173346 ; Pax2-004; intron 4
ENSMUST00000174490 ; Pax2-001; intron 5
ENSMUST00000004340 ; Pax2-201; intron 6
Database links

Mature sequence mmu-miR-6405

Accession MIMAT0025157
Sequence

96 -  

gugggaagcagugggaagcagug

 - 118

Get sequence
Deep sequencing19 reads, 6 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).