Stem-loop sequence mmu-mir-6407

AccessionMI0021944 (change log)
Symbol MGI:Mir6407
DescriptionMus musculus miR-6407 stem-loop
Stem-loop
   -     -gug      ucg    c   a    --au  u     g    --   g 
5'  gugag    acuucc   ggug cac uugc    uc gggga cagc  agg a
    |||||    ||||||   |||| ||| ||||    || ||||| ||||  |||  
3'  cacuu    ugaagg   uuac gug aacg    ag ucccu gucg  ucc a
   a     auaa      --u    u   -    ggac  -     -    gu   g 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 53010656-53010756 [-]
sense
OTTMUST00000113641 ; Xpnpep1-003; intron 4
OTTMUST00000113637 ; Xpnpep1-002; intron 5
OTTMUST00000113640 ; Xpnpep1-008; intron 5
OTTMUST00000113636 ; Xpnpep1-004; intron 6
OTTMUST00000113635 ; Xpnpep1-011; intron 7
OTTMUST00000113638 ; Xpnpep1-001; intron 7
ENSMUST00000182534 ; Xpnpep1-003; intron 4
ENSMUST00000182877 ; Xpnpep1-002; intron 5
ENSMUST00000183188 ; Xpnpep1-008; intron 5
ENSMUST00000182500 ; Xpnpep1-004; intron 6
ENSMUST00000183274 ; Xpnpep1-011; intron 7
ENSMUST00000183108 ; Xpnpep1-001; intron 7
ENSMUST00000069988 ; Xpnpep1-201; intron 7
Database links

Mature sequence mmu-miR-6407

Accession MIMAT0025160
Sequence

56 - 

uggcugucccugacagggcaagu

 - 78

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).