Stem-loop sequence mmu-mir-6414

AccessionMI0021952 (change log)
Symbol MGI:Mir6414
DescriptionMus musculus miR-6414 stem-loop
Stem-loop
   u         --      cc  gcucu      ---     ua 
5'  auaaggcuu  uucaga  cu     uugggg   gcuug  g
    |||||||||  ||||||  ||     ||||||   |||||  c
3'  uguucugag  gagucu  ga     gacccc   uggac  u
   u         uc      -u  -aucu      uuu     cc 
Get sequence
Deep sequencing
6 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 41891342-41891423 [+]
intergenic
Database links

Mature sequence mmu-miR-6414

Accession MIMAT0025168
Sequence

59 - 

cuaaguucugagcugagucuug

 - 80

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).