Stem-loop sequence mmu-mir-6417

AccessionMI0021955 (change log)
Symbol MGI:Mir6417
DescriptionMus musculus miR-6417 stem-loop
Stem-loop
   a    aaaa  a    ----c   cg   -a    a g     u   c        g    u 
5'  cggu    ga gaac     cac  agu  gcaa c acagc agc acauagcu uguc g
    ||||    || ||||     |||  |||  |||| | ||||| ||| |||||||| |||| u
3'  gucg    cu cuug     gug  ucg  uguu g ugucg ucg uguguugg acag g
   a    ---c  c    aucau   ug   cc    a -     -   -        g    a 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 52135902-52136017 [-]
intergenic
Database links

Mature sequence mmu-miR-6417

Accession MIMAT0025172
Sequence

25 - 

uagcaaacgacagcuagccaca

 - 46

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).