Stem-loop sequence mmu-mir-6419

AccessionMI0021957 (change log)
Symbol MGI:Mir6419
DescriptionMus musculus miR-6419 stem-loop
Stem-loop
   ---------a    - -    c    -aaa  uua   -g        -aucu     a  gaga 
5'           cuca c acug uuca    ug   aga  cagcagca     gacac ug    a
             |||| | |||| ||||    ||   |||  ||||||||     ||||| ||     
3'           gagu g ugac aagu    ac   ucu  gucgucgu     uugug ac    u
   acaaaggaua    a a    -    gaag  ---   ga        gcacg     -  aaag 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 17563514-17563626 [+]
antisense
OTTMUST00000026732 ; Nebl-001; intron 3
ENSMUST00000028080 ; Nebl-001; intron 3
Database links

Mature sequence mmu-miR-6419

Accession MIMAT0025175
Sequence

28 - 

cagcagcaaucugacacaugga

 - 49

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).