Stem-loop sequence hsa-mir-6817

AccessionMI0022662 (change log)
Symbol HGNC:MIR6817
DescriptionHomo sapiens miR-6817 stem-loop
Literature search

2 open access papers mention hsa-mir-6817
(2 sentences)

Stem-loop 
   aggauu       a   a c ug   u    cu ac 
5'       cugccau gga g u  gag ggaa  g  c
         ||||||| ||| | |  ||| ||||  |  u
3'       gacggua ccu c a  cuc cuuu  c  g
   ------       -   - - gu   u    cc cc
Get sequence
Deep sequencing
134 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 25455646-25455711 [+]
sense
OTTHUMT00000320305 ; KIAA1671-002; intron 2
OTTHUMT00000320306 ; KIAA1671-001; intron 7
ENST00000494730 ; KIAA1671-002; intron 2
ENST00000358431 ; KIAA1671-201; intron 4
ENST00000406486 ; KIAA1671-001; intron 7
Database links

Mature sequence hsa-miR-6817-5p

Accession MIMAT0027534
Sequence

6 -  

ucugccauaggaagcuuggagugg

 - 29

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6817-3p

Accession MIMAT0027535
Sequence

47 -  

ucucucugacuccauggca

 - 65

Get sequence
Deep sequencing118 reads, 53 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).