Stem-loop sequence hsa-mir-6821

Accession

MI0022666 (change log)

Symbol

HGNC:MIR6821

Description

Homo sapiens miR-6821 stem-loop

Literature search

1 open access papers mention hsa-mir-6821
(3 sentences)

Stem-loop

   --     ug    cuc    -     gug       -c    
5'   gugcg  gugg   gagg cgggg   ggggccu  gcc 
     |||||  ||||   |||| |||||   |||||||  || c
3'   cacgc  cgcc   cucc guccc   ucccggg  cgu 
   ga     cu    --u    a     ---       uu    

Deep sequencing

60 reads, 5.41 reads per million, 37 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr22: 49962866-49962939 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000317433 ; C22orf34-004; intron 1

  OTTHUMT00000317434 ; C22orf34-005; intron 1

  ENST00000414287 ; C22orf34-004; intron 1

  ENST00000416411 ; C22orf34-005; intron 1

Database links

• HGNC:MIR6821
• miRBase Tracker:MI0022666

Mature sequence hsa-miR-6821-5p

• Accession: MIMAT0027542
• Sequence: 1 - gugcgugguggcucgaggcgggg - 23
• Deep sequencing: 28 reads, 20 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-6821-5p
  • miRDB:hsa-miR-6821-5p

Mature sequence hsa-miR-6821-3p

• Accession: MIMAT0027543
• Sequence: 54 - ugaccucuccgcuccgcacag - 74
• Deep sequencing: 6 reads, 6 experiments
• Evidence: experimental; meta-analysis [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-6821-3p
  • miRDB:hsa-miR-6821-3p

References

1. PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).