Stem-loop sequence dev-mir-D14

AccessionMI0023593 (change log)
DescriptionDuck enteritis virus miR-D14 stem-loop
Stem-loop
     uu       cgu       u  u   -  --cu     a 
5' uu  gaagcau   augacua au uaa gc    uccga c
   ||  |||||||   ||||||| || ||| ||    |||||  
3' ag  uuuugua   uauuggu ug auu cg    agguu a
     gu       --u       c  u   g  uuuc     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D14-3p

Accession MIMAT0028187
Sequence

51 - 

gcguuaugucugguuauuauguuuuu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).