Stem-loop sequence dev-mir-D18

AccessionMI0023597 (change log)
DescriptionDuck enteritis virus miR-D18 stem-loop
Stem-loop
   u    au     a        u   -    u 
5'  uggg  cggug ggggggau gug guuu a
    ||||  ||||| |||||||| ||| |||| u
3'  accc  gucgc cuccccua cac caaa u
   a    cg     -        c   u    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D18-5p

Accession MIMAT0028192
Sequence

3 - 

gggaucggugaggggggauugug

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dev-miR-D18-3p

Accession MIMAT0028193
Sequence

42 - 

ccauccccuccgcuggccccaa

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).