Stem-loop sequence dev-mir-D19

AccessionMI0023598 (change log)
DescriptionDuck enteritis virus miR-D19 stem-loop
Stem-loop
          ga     g     ggga 
5' gaugaaa  gcggu ccuuu    u
   |||||||  ||||| |||||    c
3' uuauuuu  uguua ggggg    g
          gg     g     agug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D19-5p

Accession MIMAT0028194
Sequence

1 - 

gaugaaagagcggugccuuu

 - 20

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).