Stem-loop sequence dev-mir-D23

AccessionMI0023602 (change log)
DescriptionDuck enteritis virus miR-D23 stem-loop
Stem-loop
       c ug     c gu u    --u       ua 
5' gguc g  gacug g  g guuc   gcggcuc  u
   |||| |  ||||| |  | ||||   |||||||  c
3' ccag c  cugac c  c caag   cgcugag  u
       a gu     a ug -    cgc       cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence dev-miR-D23-3p

Accession MIMAT0028200
Sequence

46 - 

cgcgaaccgucacagucugcag

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).