Stem-loop sequence mes-MIR156e

AccessionMI0024211 (change log)
DescriptionManihot esculenta miR156e stem-loop
Gene family MIPF0000008; MIR156
Literature search

6 open access papers mention mes-MIR156e
(18 sentences)

Stem-loop
      a         -    -        a        uuu     a 
5' gaa uugacagaa gaga gugagcac cagaggca   guaua a
   ||| ||||||||| |||| |||||||| ||||||||   |||||  
3' cuu gacugucuu cucu cacucgug guuuucgu   cauau u
      c         u    u        c        ucc     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03049: 344166-344255 [+]
intergenic
Database links

Mature sequence mes-miR156e

Accession MIMAT0029169
Sequence

6 - 

ugacagaagagagugagcac

 - 25

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).