Stem-loop sequence mes-MIR156i

AccessionMI0024215 (change log)
DescriptionManihot esculenta miR156i stem-loop
Gene family MIPF0000008; MIR156
Literature search

6 open access papers mention mes-MIR156i
(18 sentences)

Stem-loop
   u         -                 -   u    aauuaa 
5'  ugacagaag auagagagcacagauga uga gugc      u
    ||||||||| ||||||||||||||||| ||| ||||      g
3'  acugucuuc uaucucucguguuuacu acu uacg      g
   -         g                 c   c    acucaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold08935: 29237-29322 [+]
intergenic
Database links

Mature sequence mes-miR156i

Accession MIMAT0029173
Sequence

1 - 

uugacagaagauagagagcac

 - 21

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).