Stem-loop sequence mes-MIR156k

AccessionMI0024217 (change log)
DescriptionManihot esculenta miR156k stem-loop
Gene family MIPF0000008; MIR156
Literature search

6 open access papers mention mes-MIR156k
(24 sentences)

Stem-loop
   u u          - a         -a    c  uu  c     a 
5'  g ugacagaaga g gagagcaca  cccg ca  gg ugaag g
    | |||||||||| | |||||||||  |||| ||  || ||||| a
3'  c acugucuucu c cucucgugu  gggu gu  uc auuuc g
   a u          g c         ga    u  uu  -     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02421: 988565-988654 [+]
intergenic
Database links

Mature sequence mes-miR156k

Accession MIMAT0029175
Sequence

3 - 

uugacagaagagagagagcac

 - 23

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).
2
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).